effect of FSH on preantral follicle development

For the practical sessions you will now have some first‐hand experience in microdissection of small
ovarian follicles, preparation of basic culture media and setting up a system to maintain these
follicles in vitro. Aside from this practical experience, you will appreciate now that these follicles
can grow in an artificial environment in the absence of a blood supply, albeit with minimal
supplementation. This culture system therefore lends itself as a useful model to understand how growth
factors or hormones (or anything added exogenously to the culture medium) can potentially influence
preantral follicle development. For this particular experiment we are interested in understanding how
preantral follicles respond to FSH; both in terms of their growth and regulation of genes essential for
further development and differentiation.
Thus, your write-up for this work will focus on a simple aim:
Aim: To examine the effect of FSH on preantral follicle development
Your assignment is to write this experiment up in a format that is commonly used by scientists when
preparing research for publication in a journal.Typically this consists of the following components:
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Scientific publications often reflect the combined efforts and experience of many individuals who have
gathered and analysed data from months or years of work. Obviously due to time constraints the quality
and quantity of data you have is rather more limited. You will notice in the literature the amount of
information in research articles varies considerably depending on the journal, but also the format of
the paper. Although the general format above is often used, every journal comes with its own detailed
set of guidelines, which almost always includes a (rather restrictive) word-count. This means years of
research often has to be written very succinctly in order to encapsulate all of the important
information in only a few thousand words. Scientists must therefore consider these criteria and be
prepared write in a style that suits the journal, or the type of article being presented.
For this write-up you will prepare a “brief report”, restricted to2,100 words (excluding the abstract
and figure legends). Results should mainly focus on two aspects:
(i) Analysis of follicle growth –‐ instructions will be provided on MOLE for measuring and analysing
your follicle images.
(ii) Relative expression of your gene –‐ guidance given and also an Excel example provided on MOLE.
However, there are other aspects that you may want to include. You should construct your report
according the
following guidance and instructions, it is essential to adhere to the word limits where stated:
Title Page:
Include a full title of the report, student number, word count for each of the five main sections
(Abstract, Introduction, Methods, Results, Discussion). Please also provide a total word count for the
Intro/Methods/Results/Discussion – which together should not exceed 2,100 words.
Abstract: (limited to a maximum of 250 words – note this does not count towards the 2,100 word limit)
Briefly describe the purpose of the study, the methods used, the results obtained and the main
conclusions. Most abstracts in PubMed are restricted to 250 words, so use these as examples. This
section is often the last to be written.
Introduction: (limited to a maximum of 400 words)
Give a brief background into study, citing any relevant literature. It may help to write this as though
you were justifying your study to someone who has a good knowledge of biology in general, but knows
little about the ovary. You have been given an aim (above), but you need to think about constructing a
hypothesis based on what has been done – what do you expect will be the outcome? Try and convincingly
build an argument that justifies your study by identifying any gaps in literature. Clearly state the
aim and hypothesis toward the end of the introduction, but this should be incorporated into the text
(i.e. not separate standalone statements). Remember, this is a bit of a marketing exercise; you are
trying to convince the reader that it is worth reading on.
Materials and Methods:
The methods used in this study are based on a recent publication1 and most information can be found
either
here1, in your lab protocols, through online links, or in your own notes. Methods should be divided
into several subheadings, for example the following are suggestions:
. (i) Animals and follicle isolation
. (ii) Preantral follicle culture and imaging
. (iii) RNA extraction, cDNA synthesis and PCR
. (iv) Quantitative PCR
. (v) Statistical analysis
You should also include any primer sequences used; for the purposes of this report you will be
presenting data provided from a single gene. The sequences of primers used are available to download
from MOLE.
You will also need to provide sequences for the reference gene (housekeeping gene)
Hypoxanthine phosphoribosyltransferase 1 (Hprt1; 105bp) …and don’t forget Growth differentiation
factor 9 (Gdf9). The source of any chemicals, reagents or hormones should also be stated.
APPENDIX I: Primer sequences
APPENDIX II: Marking schedule
The final mark given will be out of 100 and will be averaged from 2 independent markers (i.e. double
marked).

Gene symbol Primer sequence (5’–>3’) Product size (bp)

Gdf9 Fwd TCACCTCTACAATACCGTCCGG
Rev GAGCAAGTGTTCCATGGCAGTC
139
Hprt1 Fwd GTTGTTGGATATGCCCTTGACT
Rev GCGCTCATCTTAGGCTTTGTAT 105

Cyp11a1 Fwd CTGGGCACTTTGGAGTCAGT
Rev AGGACGATTCGGTCTTTCTTC
185

Cyp19a1 Fwd ATCCACACTGTTGTGGGTGA
Rev ACTCGAGCCTGTGCATTCTT 211

You are not expected to go into considerable detail with the methods, but it is important your
description demonstrates that you clearly understand what was done.
1Fenwick et al., Endocrinology (2013) 154 (9): 3423-3436
Results:
This section is limited to a maximum of 4 figures/tables and should at the very least include graphical
data of follicle growth and quantitative PCR. These results may also be supplemented with other
elements such as follicle images, gel images etc…
Results should also include a narrative of the findings and every figure should be referred in the
text. Think about what you can describe; for instance, what did the follicles look like – were they
spherical, what cell types could you see? Was follicle ‘growth’ due to expansion of the granulosa
layer, the oocyte or both? Were you able to measure oocyte diameters? Do you have examples of atretic
follicles, and if so, what morphological characteristics do they have? What does the graph indicate?
What was the mean fold change in gene expression? Was the difference statistically significant?
Discussion: (minimum 500 words, maximum 800 words)
This section is about interpretation of results (not
re-stating results). If you read any well written papers, you will notice that the discussion should
almost read like an independent body of work. Importantly, it lacks technical detail, but emphasises
the main findings in context with the literature. Have you managed to prove or disprove your
hypothesis? Are there similar studies and how do your findings compare with these? What are the wider
implications of this study? Normally in journal articles you cannot speculate about the meaning of your
findings unless you can back up your comments with appropriate references; however, we will allow a
certain level of speculation if it demonstrates rational and innovative thinking.
References:
Although not essential, it is advisable to use a referencing programme such as RefWorks or EndNote.
Either way, it is important that you follow the Harvard format described in the course handbook when
citing references in the text and preparing the reference list. Your report should include a minimum of
12 references and there is no maximum. A maximum of 3 review articles are allowed.

The report should be prepared with a word processor and printed at 1.5 spacing using a 12-point
standard font
(e.g. Times New Roman, Arial, etc.). Figure legends and footnotes may be 1 or 2 font sizes smaller than
the
main text. The word count is from the beginning of the Introduction to the end of the Discussion (i.e.
includes all
of the Introduction, Materials and Methods, Results and Discussion, with the exception of figure
legends and
footnotes). Please ensure you use a spell checker throughout.
Each figure should be on a separate page with an accompanying legend. Figures should be clear and well
constructed and annotated if necessary. Image/photo-based figures and graphs can easily be constructed
using
Powerpoint and Excel respectively. Colour or black and white is acceptable but avoid using unnecessary
features
such as 3-D graphs etc. Statistical differences in any quantitative data should be indicated using
symbols such as asterisks.

Materials and methods part one;
part two:

Gene expression and analysis
(i) Total RNA extraction
Aim:
To isolate total RNA from cultured preantral follicle samples
We will be using RNeasy Micro Kits from QIAGEN (cat no. 74004) to extract total RNA from the frozen
follicle samples. This is approach has been optimised for dealing with very small numbers of cells. The
principle behind this product is described in detail on the QIAGEN web site
http://www.qiagen.com/products/catalog/sample- technologies/rna-sample-technologies/total-rna/rneasy-
micro-kit#productdetails
Materials:
All of the solutions and reagents required for this session have been provided in aliquots. This
includes the following:

Reagent Volume required for 2 samples
70% ethanol ……………………………………… 150 μl
80% ethanol……………………………………… 1ml
Buffer RLT + -mercaptoethanol (1%) ……………… 150 μl
Carrier RNA (4ng/μl) ………………………………………. 10 μl
DNase I …………………………………………………………… 20 μl
Buffer RDD……………………………………………………… 140 μl
Buffe rRW1……………………………………………………… 700 μl
Buffer RPE
………………………………………. 1ml
RNase free water …………………………………………….. 28 μl

(ii) cDNA synthesis
Aim:
To reverse transcribe the RNA into cDNA
First we will concentrate our RNA samples by reducing the volume from 14 μl to approximately 5 μl. This
will allow us to add the entire RNA sample to the RT reaction. To concentrate RNA, all samples will be
loaded into a vacuum centrifuge and spun for 5- 10 minutes; during this time the water content will be
reduced by evaporation, leaving the RNA at the bottom of the tube.
We will then set up our reverse transcription (RT) reactions. For this we will use the SuperScript III
First-strand synthesis system (cat no. 18080-051) from Life Technologies. The principle behind this
product is described in detail on the Life Technologies web site
http://www.lifetechnologies.com/order/catalog/product/18080051?ICID=search- 18080051
Materials:
All of the solutions and reagents required for this session have been provided in aliquots. This
includes the following:
Reagent Volume required for 2 samples
Random hexamers (50 ng/μl) 2μl
dNTP mix (10 mM) 2μl
RNase free water
RT buffer (10x) 4μl
MgCl2 (25 mM) 8μl
DTT (0.1 M) 4μl
RNase OUT (40U/μl)
 2μl
SuperScript III RT enzyme (200 U/μl) 2μl
(iii) PCR and gel electrophoresis
Aim:
To check the quality of your cDNA samples by amplifying an oocyte-specific gene using PCR and
visualising the product on a gel.
You will be supplied with all of the reagents for setting up the PCR reaction. To make things simple we
will be using a commercial reaction mix (MyTaq Red Mix) from Bio- Line, which contains most of the
components required for the PCR reaction. Information about the product can be found here
https://www.bioline.com/h_prod_detail.asp?itemid=268
Although, this is a very simple procedure it still requires careful pipetting! We will amplify Growth
differentiation factor 9 (Gdf9), an oocyte-specific gene highly expressed in preantral follicles. The
primers supplied have been designed to detect a 139 base pair fragment of mouse Gdf9, and have the
following sequences:
Forward: TCACCTCTACAATACCGTCCGG Reverse: GAGCAAGTGTTCCATGGCAGTC
Materials:
NOTE: There is enough cDNA for each person to set up your own reactions.
Reagent Volume required for 3 reactions (2 follicle samples and a –ve
control)
Follicle cDNA
 2μl
Primers (20 μM)
3μl
MyTaq Red PCR Mix, 2x 75 μl
RNase free water 70 μl
Gene expression and analysis
(iv) Quantitative (real-time) PCR
Aim:
To compare differences in gene expression (mRNA) between follicle samples cultured in the presence or
absence of FSH.
Like yesterday, we will use a reaction mix containing most of the components for your reactions. For
this purpose we will use SYBR green JumpStart Taq Ready Mix from Sigma. Information on this product can
be found here http://www.sigmaaldrich.com/catalog/product/sigma/s4438?lang=en&region=GB The concept is
practically the same as yesterday, except this reaction mix contains a fluorescent dye (SYBR green)
that incorporates into double stranded DNA. Thus, as the PCR reaction proceeds, and more DNA product
forms, the amount of fluorescence will also increase. In other words, the amount of fluorescence is
directly proportional to the amount of DNA. The machine can read this fluorescence in real-time. By
comparing the amount of fluorescence in one sample (e.g. the control follicles) relative to the other
sample (e.g. the FSH-treated follicles), we can calculate the difference in gene expression.
A brief tutorial and guidance on how to analyse qPCR data will be provided during the assessment
guidance session on Monday.
When determining changes in gene expression, we are interested to know whether the result is truly
representative of the experiment and not just a random effect. Therefore, we will measure the
expression of your gene in everyone’s cDNA samples, not just your own. This allows us to gauge
‘biological variability’, since each pair of cDNA samples was originally derived from a different
mouse. You will also prepare each reaction in duplicate; this is to account for ‘technical variability’
that can arise through pipetting.
Materials:
NOTE: Each person will set up there own reactions.
Volume required for 20 reactions (3 control
follicle samples, 3 FSH-treated follicle samples, 1 –ve (no cDNA) control = 7, in duplicate = 14,
adjusted up to 16 to allow for pipetting error)
Reagent
Follicle cDNA
Primers (20 μM 0.5μlx16=8μl
SYBR Green JumpStart Ready Mix, 2x 10 μl x 16 = 160 μl
ROX reference dye 0.2 μl x 16 = 3.2 μl
RNase free water 8.3 μl x 16 = 132.8 μl

Results:
Control follicles:
Day0 day1 day2 day3
1) 124.529 135.019 110.343 104.646
2) 119.83 133.838 120.380 144.327
3) 139.58 141.014 125.707 135.275
4) 155.0 131.638 123.313 145.456
5) 149.704 119.417 112.96 117.641
6) 131.108 127.172 120.954 170.965
7) 152.073 114.653 110.637 follicle lysed
8) 152.265 follicle lysed follicle lysed follicle lysed
compare Day 0 to day 1, 2 and 3 using t-test and then do a graph
Follicles with FSH:
Day0 day1 day2 day3
1) 140.902 121.491 106.622 119.777
2) 107.421 196.802 94.974 88.43
3) 135.933 131.013 113.345 151.773
4) 176.505 129.887 113.897 147.574
5) 160.257 121.466 109.233 135.928
6) 115.251 118.334 112.033 110.069
7) 163.731 126.249 102.571 150.604
8) 169.176 119.263 103.232 106.911
compare Day 0 to day 1, 2 and 3 using t-test and then do a graph (using one graph of control and FSH)

TO HAVE YOUR ASSIGNMENTS DONE AT A CHEAPER PRICE, PLACE THIS ORDER OR A SIMILAR ORDER WITH US NOW.